ID: 1166244594_1166244600

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1166244594 1166244600
Species Human (GRCh38) Human (GRCh38)
Location 19:41516605-41516627 19:41516624-41516646
Sequence CCCAGGCCTGGTTTCGGGTCTGG CTGGTTTTGGATCTGGTGCCTGG
Strand - +
Off-target summary {0: 31, 1: 84, 2: 94, 3: 57, 4: 224} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!