ID: 1166244597_1166244600

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1166244597 1166244600
Species Human (GRCh38) Human (GRCh38)
Location 19:41516611-41516633 19:41516624-41516646
Sequence CCTGGTTTCGGGTCTGGTTTTGG CTGGTTTTGGATCTGGTGCCTGG
Strand - +
Off-target summary {0: 4, 1: 13, 2: 4, 3: 17, 4: 164} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!