ID: 1166268201_1166268206

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1166268201 1166268206
Species Human (GRCh38) Human (GRCh38)
Location 19:41697635-41697657 19:41697653-41697675
Sequence CCCTGCAGGTACAATACATGTGG TGTGGGGACAGTCTGTACCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 8, 4: 93} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!