ID: 1166360266_1166360273

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1166360266 1166360273
Species Human (GRCh38) Human (GRCh38)
Location 19:42250202-42250224 19:42250243-42250265
Sequence CCCAAGGTCACACAGCTAGGATT GACCCAATGCTTGTTCCCACAGG
Strand - +
Off-target summary {0: 1, 1: 18, 2: 168, 3: 927, 4: 3199} {0: 1, 1: 0, 2: 1, 3: 8, 4: 76}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!