ID: 1166381347_1166381357

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1166381347 1166381357
Species Human (GRCh38) Human (GRCh38)
Location 19:42356845-42356867 19:42356882-42356904
Sequence CCCGCTCCTTCCATGCAGCCGCA CCGTGGTGCCATGTATCTGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 6, 3: 91, 4: 1282} {0: 1, 1: 0, 2: 1, 3: 12, 4: 78}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!