ID: 1166499811_1166499821

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1166499811 1166499821
Species Human (GRCh38) Human (GRCh38)
Location 19:43332361-43332383 19:43332408-43332430
Sequence CCACTGCCATGGCCTCCTCTGAC GGGGCTGATGGCGCTGTCCTGGG
Strand - +
Off-target summary {0: 2, 1: 1, 2: 7, 3: 48, 4: 481} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!