ID: 1166509363_1166509368

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1166509363 1166509368
Species Human (GRCh38) Human (GRCh38)
Location 19:43394213-43394235 19:43394255-43394277
Sequence CCTTTGTCTTAAAACTGGAGTCC GAAATCCCAGCAAGATAAGAAGG
Strand - +
Off-target summary No data {0: 3, 1: 0, 2: 1, 3: 61, 4: 278}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!