ID: 1166539244_1166539249

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1166539244 1166539249
Species Human (GRCh38) Human (GRCh38)
Location 19:43594710-43594732 19:43594739-43594761
Sequence CCCCAAACTCACTGGGGGAGGGA GGACCTCCATGGTCGCACCTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 218} {0: 1, 1: 0, 2: 0, 3: 10, 4: 54}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!