ID: 1166679230_1166679239

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1166679230 1166679239
Species Human (GRCh38) Human (GRCh38)
Location 19:44757165-44757187 19:44757200-44757222
Sequence CCCTGCTGGACAGCGCAGCTCCG CTGGAGGCCCGCAATTATGACGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 18, 4: 177} {0: 1, 1: 0, 2: 0, 3: 5, 4: 39}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!