ID: 1166718823_1166718830

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1166718823 1166718830
Species Human (GRCh38) Human (GRCh38)
Location 19:44985983-44986005 19:44986022-44986044
Sequence CCTGGGTGGCGGAATCTCTAAGC TCTGCCAGCAGTTGCTGTGGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 61} {0: 1, 1: 0, 2: 0, 3: 29, 4: 276}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!