ID: 1166867428_1166867436

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1166867428 1166867436
Species Human (GRCh38) Human (GRCh38)
Location 19:45848485-45848507 19:45848534-45848556
Sequence CCTAGCCCAGGGCTAAGCACAGA GTGAATAAACGGATGGTCAATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 15, 3: 79, 4: 628} {0: 1, 1: 0, 2: 0, 3: 7, 4: 113}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!