ID: 1166925675_1166925679

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1166925675 1166925679
Species Human (GRCh38) Human (GRCh38)
Location 19:46265468-46265490 19:46265495-46265517
Sequence CCTATTTCAGCCCAGCAGGGTGG CACCTGTAATCCCAGACCTTTGG
Strand - +
Off-target summary No data {0: 16, 1: 2331, 2: 80119, 3: 221328, 4: 292991}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!