ID: 1167042838_1167042842

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1167042838 1167042842
Species Human (GRCh38) Human (GRCh38)
Location 19:47032710-47032732 19:47032728-47032750
Sequence CCATCTATCTGGGTCTCTCACAG CACAGGTAAGGGACCCCCAGTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 4, 3: 18, 4: 513} {0: 1, 1: 0, 2: 1, 3: 11, 4: 156}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!