ID: 1167045411_1167045423

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1167045411 1167045423
Species Human (GRCh38) Human (GRCh38)
Location 19:47046281-47046303 19:47046332-47046354
Sequence CCAAGGTCGGGGGATGGTCTGGG CAGAGGCAGGGCCGTGCCAGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 35, 4: 461} {0: 1, 1: 0, 2: 7, 3: 58, 4: 375}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!