ID: 1167110330_1167110337

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1167110330 1167110337
Species Human (GRCh38) Human (GRCh38)
Location 19:47456963-47456985 19:47457004-47457026
Sequence CCGTCCTCAGTGCGGTAGTCCAC CTCGCCGCCCTGGCACGTGACGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 63} {0: 1, 1: 0, 2: 0, 3: 2, 4: 55}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!