ID: 1167129173_1167129195

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1167129173 1167129195
Species Human (GRCh38) Human (GRCh38)
Location 19:47573146-47573168 19:47573195-47573217
Sequence CCCGCCTTCCCCGCGCCGCCCGG CGGATCTCCTCGCTCACGCGCGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 5, 3: 74, 4: 557} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!