ID: 1167439539_1167439549

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1167439539 1167439549
Species Human (GRCh38) Human (GRCh38)
Location 19:49500381-49500403 19:49500407-49500429
Sequence CCTGTTCAGTGGTACCGGGGCCC CTGCTGGGAAGGAAGTGGGCAGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!