ID: 1167447794_1167447797

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1167447794 1167447797
Species Human (GRCh38) Human (GRCh38)
Location 19:49548737-49548759 19:49548786-49548808
Sequence CCACTGATCTCAGCTCACTGATC CTTCAGCCTCCCTAGTAGCTGGG
Strand - +
Off-target summary No data {0: 375, 1: 17282, 2: 225605, 3: 281316, 4: 182884}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!