ID: 1167499123_1167499132

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1167499123 1167499132
Species Human (GRCh38) Human (GRCh38)
Location 19:49835750-49835772 19:49835767-49835789
Sequence CCAGCCTCAGGGTACCGTAGGGG TAGGGGCCTCTGGGGCCACGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 70} {0: 1, 1: 0, 2: 1, 3: 32, 4: 204}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!