ID: 1167703658_1167703666

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1167703658 1167703666
Species Human (GRCh38) Human (GRCh38)
Location 19:51065752-51065774 19:51065767-51065789
Sequence CCTGGCCTCCCCCTCTCCACCCC TCCACCCCCAGTGGCTCAGCGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 5, 3: 25, 4: 212}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!