ID: 1167703671_1167703683

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1167703671 1167703683
Species Human (GRCh38) Human (GRCh38)
Location 19:51065774-51065796 19:51065811-51065833
Sequence CCAGTGGCTCAGCGGGATGTCTC CTGGGCTTGGCCCTCTGCTTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 82} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!