ID: 1167843617_1167843622

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1167843617 1167843622
Species Human (GRCh38) Human (GRCh38)
Location 19:52141704-52141726 19:52141725-52141747
Sequence CCCAGTGAATCCTTGGGTTGACA CATGCAAGGGAAGAACCCATAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 12, 4: 137}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!