ID: 1168052138_1168052144

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1168052138 1168052144
Species Human (GRCh38) Human (GRCh38)
Location 19:53837278-53837300 19:53837331-53837353
Sequence CCATGTGAAATAAACAGCCATGT TCACACGGACGCGCATGAAATGG
Strand - +
Off-target summary No data {0: 2, 1: 9, 2: 10, 3: 11, 4: 43}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!