ID: 1168163505_1168163513

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1168163505 1168163513
Species Human (GRCh38) Human (GRCh38)
Location 19:54529281-54529303 19:54529331-54529353
Sequence CCCTCCACCAATTGAAGATAAGA CTTCACGTTAGTATTGAGGAAGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!