ID: 1168217372_1168217377

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1168217372 1168217377
Species Human (GRCh38) Human (GRCh38)
Location 19:54936200-54936222 19:54936214-54936236
Sequence CCCCAGCAACACGGTGCAGTGGA TGCAGTGGACTCCAGGTGCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 120} {0: 1, 1: 0, 2: 1, 3: 24, 4: 180}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!