ID: 1168217372_1168217381

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1168217372 1168217381
Species Human (GRCh38) Human (GRCh38)
Location 19:54936200-54936222 19:54936244-54936266
Sequence CCCCAGCAACACGGTGCAGTGGA GTGACCGTGAGACCCACCTCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 120} {0: 1, 1: 0, 2: 0, 3: 9, 4: 89}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!