ID: 1168282814_1168282821

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1168282814 1168282821
Species Human (GRCh38) Human (GRCh38)
Location 19:55314607-55314629 19:55314630-55314652
Sequence CCCACCCAAGAGACTACTGAGTC CCACAGAATGAAGGCCCCTGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 64} {0: 1, 1: 0, 2: 0, 3: 23, 4: 231}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!