ID: 1168290090_1168290102

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1168290090 1168290102
Species Human (GRCh38) Human (GRCh38)
Location 19:55353352-55353374 19:55353399-55353421
Sequence CCCTGGGCTGGCTCGTAGCTGTC ATGGAGAGGGAGAAGGGGGACGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 100} {0: 1, 1: 1, 2: 64, 3: 772, 4: 3725}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!