ID: 1168536423_1168536436

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1168536423 1168536436
Species Human (GRCh38) Human (GRCh38)
Location 19:57174101-57174123 19:57174141-57174163
Sequence CCACGCCGGGCCCACCTCAGGTG TCCCAAAGTGTTGAGATTACAGG
Strand - +
Off-target summary No data {0: 1587, 1: 40620, 2: 330951, 3: 247333, 4: 128774}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!