ID: 1168605673_1168605679 |
View in Genome Browser |
Spacer: 5 |
| Left Crispr | Right Crispr | |
|---|---|---|
| Crispr ID | 1168605673 | 1168605679 |
| Species | Human (GRCh38) | Human (GRCh38) |
| Location | 19:57758353-57758375 | 19:57758381-57758403 |
| Sequence | CCAGCTCAGCTACAGTAGGATAG | CAGGCTGAGGCCCCTATTCTAGG |
| Strand | - | + |
| Off-target summary | {0: 8, 1: 137, 2: 465, 3: 926, 4: 1187} | No data |
| Status | Not started | |
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer | Left Crispr | Right Crispr | ||||||
|---|---|---|---|---|---|---|---|---|
| Location | Sequence | Mismatches | Strand | Location | Sequence | Mismatches | Strand | |
| No off target data available for this pair! | ||||||||