ID: 1168634412_1168634417

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1168634412 1168634417
Species Human (GRCh38) Human (GRCh38)
Location 19:57984433-57984455 19:57984474-57984496
Sequence CCAATCTGAATGGAAAACAACTG GTCCCCTCCATTAGAGTGGGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 252} {0: 1, 1: 0, 2: 0, 3: 17, 4: 89}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!