ID: 1168666785_1168666790

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1168666785 1168666790
Species Human (GRCh38) Human (GRCh38)
Location 19:58210362-58210384 19:58210409-58210431
Sequence CCACAGGCAGGCACATCTGTATC ACCTTCAGAAATGCATACTTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 185} {0: 1, 1: 0, 2: 5, 3: 23, 4: 261}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!