ID: 1168837247_1168837259

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1168837247 1168837259
Species Human (GRCh38) Human (GRCh38)
Location 20:885407-885429 20:885457-885479
Sequence CCCTGCAGCCCGACGATGAGACT CTGTAGGCACAGATTGAGGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 3, 4: 48} {0: 1, 1: 0, 2: 2, 3: 16, 4: 211}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!