ID: 1168868528_1168868537

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1168868528 1168868537
Species Human (GRCh38) Human (GRCh38)
Location 20:1109295-1109317 20:1109315-1109337
Sequence CCCCACCACCCTACATACACACA ACAGACTGCCCCAGGATGGGAGG
Strand - +
Off-target summary {0: 1, 1: 3, 2: 17, 3: 259, 4: 1554} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!