ID: 1168874916_1168874919

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1168874916 1168874919
Species Human (GRCh38) Human (GRCh38)
Location 20:1164765-1164787 20:1164804-1164826
Sequence CCTTTCTTCAGCAGTCTTGGGTA TTTTATAGATGCAGAAAATGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 116} {0: 1, 1: 12, 2: 298, 3: 2053, 4: 7720}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!