ID: 1168986381_1168986384

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1168986381 1168986384
Species Human (GRCh38) Human (GRCh38)
Location 20:2052546-2052568 20:2052559-2052581
Sequence CCAGGCCCTTATGCTCCTATATC CTCCTATATCAGTCAGTCTTCGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!