ID: 1169083026_1169083033

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1169083026 1169083033
Species Human (GRCh38) Human (GRCh38)
Location 20:2809069-2809091 20:2809090-2809112
Sequence CCCATAACGCCTAGCGGTTACCC CCCGAGTCCGGCGGAGACAAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 11} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!