ID: 1169246719_1169246731

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1169246719 1169246731
Species Human (GRCh38) Human (GRCh38)
Location 20:4031872-4031894 20:4031891-4031913
Sequence CCCTCCCCCGCCCCCCTCTGATG GATGCCGAGCCAAAGCTGGACGG
Strand - +
Off-target summary No data {0: 54, 1: 81, 2: 38, 3: 20, 4: 170}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!