ID: 1170060172_1170060177

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1170060172 1170060177
Species Human (GRCh38) Human (GRCh38)
Location 20:12250634-12250656 20:12250667-12250689
Sequence CCATCAGTTGGTTTTCTTGGGAC CCCACCTTCCATCCTCCAAAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 160} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!