ID: 1170107772_1170107775

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1170107772 1170107775
Species Human (GRCh38) Human (GRCh38)
Location 20:12770255-12770277 20:12770277-12770299
Sequence CCTGAAGACAGAACTACCATTCG GACCCAGCAATACCATTACTGGG
Strand - +
Off-target summary No data {0: 72, 1: 6080, 2: 21667, 3: 11986, 4: 10795}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!