ID: 1170149996_1170149998

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1170149996 1170149998
Species Human (GRCh38) Human (GRCh38)
Location 20:13219650-13219672 20:13219680-13219702
Sequence CCAATTTATTAATAAGATGCTGG TAGAATTTTAAAGATGCTTCAGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!