ID: 1170275922_1170275925

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1170275922 1170275925
Species Human (GRCh38) Human (GRCh38)
Location 20:14588005-14588027 20:14588019-14588041
Sequence CCAATGTTATCTGTCTTTTTCTG CTTTTTCTGGATCTGGTATCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 58, 4: 608} {0: 1, 1: 0, 2: 75, 3: 633, 4: 1868}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!