ID: 1170446590_1170446597

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1170446590 1170446597
Species Human (GRCh38) Human (GRCh38)
Location 20:16434292-16434314 20:16434342-16434364
Sequence CCCAGATCTCGTGGGAAGAAGAC GGCCCGTGTAACCACCGTAATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 111} {0: 1, 1: 0, 2: 0, 3: 2, 4: 14}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!