ID: 1170481014_1170481019

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1170481014 1170481019
Species Human (GRCh38) Human (GRCh38)
Location 20:16764837-16764859 20:16764882-16764904
Sequence CCTAGCCTCAAGTATTCCTTTAT CACTACCCACTAGTGGAACTTGG
Strand - +
Off-target summary {0: 36, 1: 475, 2: 1507, 3: 4176, 4: 10926} {0: 1, 1: 0, 2: 0, 3: 1, 4: 60}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!