ID: 1170545917_1170545926

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1170545917 1170545926
Species Human (GRCh38) Human (GRCh38)
Location 20:17435864-17435886 20:17435882-17435904
Sequence CCCCCTGGAGAGGCCTTTGTGGA GTGGATGGCCAAACGGGGACCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 18, 4: 237} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!