ID: 1170644805_1170644810

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1170644805 1170644810
Species Human (GRCh38) Human (GRCh38)
Location 20:18188228-18188250 20:18188274-18188296
Sequence CCCTGTGTGGTCTGCAGGACTGG TTGGCGATAGACTGTCAATTAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 4, 3: 37, 4: 319} {0: 1, 1: 0, 2: 0, 3: 1, 4: 40}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!