ID: 1171119708_1171119723

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1171119708 1171119723
Species Human (GRCh38) Human (GRCh38)
Location 20:22557886-22557908 20:22557938-22557960
Sequence CCACAGCAGGGATGCCAGGTGAG CAAAGTCGGGTCCCCAAAGTCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 27, 4: 352} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!