ID: 1171252006_1171252012

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1171252006 1171252012
Species Human (GRCh38) Human (GRCh38)
Location 20:23655891-23655913 20:23655934-23655956
Sequence CCTGGGCTGCATTGAGAGGGCCG CCTCACTGAGAGACTGGAAAAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 32, 4: 335}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!