ID: 1171325062_1171325066

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1171325062 1171325066
Species Human (GRCh38) Human (GRCh38)
Location 20:24283931-24283953 20:24283961-24283983
Sequence CCCTCACACTGCTATAAAGACAT ACTAGGTAATTTATAAAGAAAGG
Strand - +
Off-target summary No data {0: 23, 1: 317, 2: 626, 3: 687, 4: 825}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!