|
Left Crispr |
Right Crispr |
Crispr ID |
1171346780 |
1171346789 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
20:24471151-24471173
|
20:24471182-24471204
|
Sequence |
CCTCATAGCCCCCAGAGCCGGCC |
CGTGCTAGGCTGCGACCTCAAGG |
Strand |
- |
+ |
Off-target summary |
{0: 1, 1: 0, 2: 0, 3: 16, 4: 197} |
{0: 1, 1: 0, 2: 0, 3: 5, 4: 56} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|